AmpExp is a targeted amplification assay designed for short, focused genomic regions requiring high accuracy and flexible sequencing depth. It excels in CRISPR/Cas9 editing validation (quantifying editing efficiency and characterizing indel patterns), 16S/ITS microbiota analysis (taxonomic classification and microbial community composition assessment), immune repertoire profiling (TCR/BCR clonotype diversity analysis), as well as barcode/variant counting and quality control (QC) of engineered gene constructs.
What AmpExp is used for ?
| 16S/ITS microbiota analysis | CRISPR/Cas9 editing validation | Immune repertoire profiling | ||
• Taxonomic profiling from targeted 16S or ITS amplicons • Assessing microbial community composition and relative abundance • Comparing microbiota changes between experimental groups | • Quantifying CRISPR/Cas9 editing efficiency • Characterizing indel patterns at targeted loci • Validating edited pools and clones | • TCR/BCR (V(D)J) targeted amplicon sequencing • Assessing clonotype diversity and relative abundance across samples • Monitoring immune repertoire dynamics across experimental groups |
Our AmpExp Amplicon NGS workflow guides you from consultation/design through sample handoff, library preparation, high-accuracy Illumina sequencing, to delivery of FASTQ data, QC summaries, and optional analysis.
Targets, primer/adapters, read length, depth plan
Drop off your PCR amplicon
Adapter ligation (if needed), Indexing, cleanup, QC
High accuracy Illumina sequencing
FASTQ + QC summary; optional analysis
| Read tiers1 | Turnaround Time2 | Data Analysis |
| 10k– 40k SE reads per sample | 3-5 Business Days | Abundance Analysis OR SNP/Indel Analysis |
| 1M PE (2M PE) reads per sample | 3-5 Business Days | |
| 3M SE (6M PE) reads per sample | 3-5 Business Days | |
| 5M SE (10M PE) reads per sample | 3-5 Business Days | |
| 10M SE (20M PE) reads per sample | 3-5 Business Days | |
| 20M SE (40M PE) reads per sample | 3-5 Business Days | |
| >20M SE (40M PE) reads per sample | Inquiry |
1 Tell us your goal (edit check vs counting vs rare variants), number of targets, and expected diversity— we’ll recommend the most cost-effective read tier.
2 Your project clock starts once we receive your samples.
Tube / plate format
• Submit samples in an 8-strip tube or 96-well plate
• Label samples clearly and include a sample list
Concentration & volume
• Optimal concentration: 15–50 ng/µL
• Volume required: 20 µL
•We recommend PCR primers that include Illumina R1 and R2 adapters
•This allows direct indexing + sequencing with minimal extra steps
•If you cannot add R1/R2, we can ligate adapters for an additional charge
Illumina adapter sequences for PCR primers
Attach the adapter sequence to the 5' end of your primers. The optional NNNNNN represents random bases (A/T/C/G) to increase sequence diversity.
5'- TCCCTACACGACGCTCTTCCGATCT NNNNNN <your forward primer> -3'
5'- GTTCAGACGTGTGCTCTTCCGATCT NNNNNN <your reverse primer> -3'
Do not send indexed samples or samples with P5/P7 adapters
Quintara delivers fast, affordable NGS sequencing using advanced platforms.
Discover more
Bulk RNA sequencing platform by Quintara enabling transcriptome-wide studies.
Discover more
Rapid, affordable Nanopore sequencing from Quintara; plasmid DNA results in one day.
Discover more