Quintara AmpExp Amplicon NGS

Overview

AmpExp is a targeted amplification assay designed for short, focused genomic regions requiring high accuracy and flexible sequencing depth. It excels in CRISPR/Cas9 editing validation (quantifying editing efficiency and characterizing indel patterns), 16S/ITS microbiota analysis (taxonomic classification and microbial community composition assessment), immune repertoire profiling (TCR/BCR clonotype diversity analysis), as well as barcode/variant counting and quality control (QC) of engineered gene constructs.

February Monday Promotion

Offer:

Starting from $29.90 promotion price and free Data Analysis

• Starting material: PCR amplicons with TruSeq R1/R2 adapters

• Sequencing: Illumina paired-end 2×300 bp

• Included depth: 10k–40k SE reads per sample

Terms and Conditions:

• The promotional pricing applies to qualifying AmpExp Amplicon NGS orders placed every Monday throughout February 2026, based on ET.

• The discount will be applied automatically when you place your order through the QuinGo online portal (Promo Code: MonAmpExp).

• Quintara Biosciences reserves all rights to this promotion.

Easy Submission
Free drop-box services available
3-5 Business Days
Full workflow support
Stringent
High-quality QC, reliable quality
Good Communication
Professional PhD team

What AmpExp is used for ?

16S/ITS microbiota analysis

CRISPR/Cas9 editing validation

Immune repertoire profiling

• Taxonomic profiling from targeted 16S or ITS amplicons

• Assessing microbial community composition and relative abundance

• Comparing microbiota changes between experimental groups

• Quantifying CRISPR/Cas9 editing efficiency

• Characterizing indel patterns at targeted loci

• Validating edited pools and clones

• TCR/BCR (V(D)J) targeted amplicon sequencing

• Assessing clonotype diversity and relative abundance across samples

• Monitoring immune repertoire dynamics across experimental groups

Need help with a custom order?

CONTACT US

Workflow

Our AmpExp Amplicon NGS workflow guides you from consultation/design through sample handoff, library preparation, high-accuracy Illumina sequencing, to delivery of FASTQ data, QC summaries, and optional analysis.

Consultation / Design
Targets, primer/adapters, read length, depth plan
Sample Handoff
Drop off your PCR amplicon
Library Preparation
Adapter ligation (if needed), Indexing, cleanup, QC
Sequencing
High accuracy Illumina sequencing
Delivery
FASTQ + QC summary; optional analysis

Services

Read tiers1	Turnaround Time2	Data Analysis
10k– 40k SE reads per sample	3-5 Business Days	Abundance Analysis OR SNP/Indel Analysis
1M PE (2M PE) reads per sample	3-5 Business Days
3M SE (6M PE) reads per sample	3-5 Business Days
5M SE (10M PE) reads per sample	3-5 Business Days
10M SE (20M PE) reads per sample	3-5 Business Days
20M SE (40M PE) reads per sample	3-5 Business Days
＞20M SE (40M PE) reads per sample	Inquiry

1 Tell us your goal (edit check vs counting vs rare variants), number of targets, and expected diversity— we’ll recommend the most cost-effective read tier.

2 Your project clock starts once we receive your samples.

Order Now Contact Us

Sample Guidelines

Sample Requirements

Tube / plate format
• Submit samples in an 8-strip tube or 96-well plate
• Label samples clearly and include a sample list
Concentration & volume
• Optimal concentration: 15–50 ng/µL
• Volume required: 20 µL
Primer / Adapter Design

•We recommend PCR primers that include Illumina R1 and R2 adapters
•This allows direct indexing + sequencing with minimal extra steps
•If you cannot add R1/R2, we can ligate adapters for an additional charge

Illumina adapter sequences for PCR primers

Attach the adapter sequence to the 5' end of your primers. The optional NNNNNN represents random bases (A/T/C/G) to increase sequence diversity.

Forward primer with R1 adapter

5'- TCCCTACACGACGCTCTTCCGATCT NNNNNN <your forward primer> -3'
Reverse primer with R2 adapter

5'- GTTCAGACGTGTGCTCTTCCGATCT NNNNNN <your reverse primer> -3'
Important notes

Do not send indexed samples or samples with P5/P7 adapters