DNA Sequencing
QuintaraBio has been providing the highest quality Sanger DNA Sequencing services to the life science research community since 2005. Our mission as the leading service provider is to ensure excellent customer service, fast turnaround time, advanced technical support and offer the best value to our customers.
SimpliSeqTM DNA Sequencing is the most commonly requested service, for plasmid DNA, PCR fragment, phage DNA, with primer premixed or unmixed.
DirectSeqTM Colony Sequencing is the best one-stop service for customers that prefer to minimize the risk of low copy number or purification quality. Just send us your bacteria colonies on agar plates or in liquid culture, and expect your data delivered to your email account within 24 hours.
QuintSeqTM On-demand Sequencing is our premium service designed to expedite the process and shorten your research cycle. After sequencing the bacterial colonies and delivering the data, we keep your colonies and plasmid for one month. During this period, we’ll send back the colony or purified plasmid based on your request without additional charge.
Benefits
- The most flexible sequencing service with the highest success rate.
- Skilled analysis of your sequencing results.
- Expert troubleshooting to optimize more complex samples (hairpin, GC-rich templates).
- Additional services (template amplification, PCR purification) are included in the service package.
- Optional sequence editing and sequence alignment are available free of charge.
Quality
- Average read lengths: 700-1000 bp
- Color printouts of chromatographs are provided free of charge upon request.
- Optional sequence alignment saves time when analyzing sequencing results.
- Sequence editing is provided upon request. (Sequence editing means a manual proofread performed by an experienced staff to correct mistakes /uncertainties in sequences generated by the automatic base caller)
- Troubleshooting: We propose further troubleshooting steps based on the sequencing results. It is your decision whether we continue sequencing your samples.
- Repeat policy: Failed samples will be repeated based on our interpretation of your sequencing results. The repeat is free of charge.
Service Name | Price/rxn (rxn 1-47)* | Price/rxn ( rxn 48-96) | Price/rxn (rxn >96) | Turnaround Time** | Deliverable |
---|---|---|---|---|---|
SimpliSeq™ DNA Sequencing | $6 | Contact for info | Contact for info | 12 Hours | Analyzed data |
Q-MaxSeq™ DNA Sequencing*** | $4 | Contact for info | Contact for info | 12 Hours | Analyzed data |
DirectSeq™ Colony Sequencing | $9 | Contact for info | Contact for info | 24 Hours | Analyzed data |
QuintSeq™ On-Demand Sequencing | $12 | Contact for info | Contact for info | 24 Hours | Data and plasmid |
PCR Cleanup | $3 | Contact for info | Contact for info | 1 Hour | Cleaned sample |
Rolling Circle Amplification | $4 | Contact for info | Contact for info | 12 Hours | Amplified Sample |
Plasmid Miniprep | $9 | Contact for info | Contact for info | 24 Hours | Purified Plasmid |
Primer Walking Complete Plasmid Sequencing |
$0.10/bp | Contact for info | Contact for info | 3-5 days | Analyzed Data |
*For regional/promotion/academic discounted price, please contact the regional sales rep click here.
**Estimated turnaround time by sample submission before the cutoff time in different territories. Please contact the regional sales rep for actual pickup schedule click here.
*** Prepaid 96 reactions each order, flexible sample submission quantity afterwards
Sample Submission Instructions
Sample Requirements
Plasmid Samples
- Plasmid DNA purified by commercially available kits
- Low copy number plasmids need to be further concentrated by spin column, ETOH precipitation, or RCA before sequencing
- Check quality and concentration of plasmid by gel electrophoresis and A260/A280
- PCR products need to be purified to eliminate primers and dNTPs
- Check quality and concentration after purification by gel electrophoresis (2ul) confirming the presence of one specific band
- For unpurified PCR samples, please mark as “unpurified PCR”
- Colonies need to grow for at least 16 hours at 37°C to reach a good visible size
- Place all samples in either tightly sealed 8-strip tubes or strip capped 96-well plate
Sample Submission Guide
Step 1 | Visit www.quintarabio.com to register for an account (PO: purchase order of your lab; if you will pay your bill by credit card, just write CC). |
Step 2 | Log in to your Quintara account. Select “Online Form” and fill in sample information, print the order receipt upon submission. |
Step 3 | Prepare samples according to the instructions on this page and view our free universal primers here; if you are using one of our universal primers you do not need to add primer to your samples. |
Step 4 | Place your samples and order receipt in the nearest Quintara Drop Box. Exact pickup time varies depending on location (contact your local representative). |
Selection Guide for Seq-A-Strip DNA Sequencing Service
Please submit sequencing samples in 8-strip PCR Tubes; if sending primer separately, send in a 1.5ml tube.
Premixed
One set of 8-strip PCR tube:

Mixed in the same tube: Template + Primer

Premixed for success
Advantages of premixed samples:
- Track samples easily
- Get results faster
- Enjoy low cost per reaction
- Improve success rate significantly
Unmixed
Two sets of tubes:

Tube 1: Template Tube 2: Primer
Primer (5 pmol/μl or 5 μM), 10 μl. Or, use our free primer library.

Primer For Sequencing:
Prefer Tm: 50-60C, GC content: 40-60%
How to Label Sample Tubes
Label the samples with your initials followed by numbers

8-strip PCR tube for samples containing template
Mark the first tube near the bottom of the tube

Label on the cap as well as on the side of the tube
E. Coli Colonies
Pick a colony and resuspend in diH2O or Tris BufferTwo sets of tubes:

Tube 1: Colony Suspension Tube 2: Primer
- Colonies need to grow for at least 16hrs at 37°C to reach good visible size
- Pick a single colony with sterile tip and resuspend in 30ul sterile diH2O or Tris buffer (10mM, ph8.0), 15 ul will be submitted to us, and the rest 15 ul will be kept by clients for future uses
- Prepare 2 separate tubes: 1 contains 15ul colony suspension, 1 contains 5ul primer at 5pmol/ul
Plasmid Walking
- 10ug plasmid DNA
- Vector information if whole plasmid sequencing is to be done
- 10ul vector primers for first round of sequencing at 5uM
- Reference or expected sequence if any
Free Primers
Available Common Primers (Complete List in Excel) || Search Online
Name | Description | Sequence |
---|---|---|
3'AOX1 | For Pichia vectors with AOX1 terminator, reverse primer | GCAAATGGCATTCTGACATCC |
5'AOX1 | For Pichia vectors with AOX1 promoter, forward primer | GACTGGTCCAATTGACAAGC |
Alpha-factor | Alpha factor signal sequence, forward primer | TACTATTGCCAGCATTGCTGC |
Amp-R | 5' end of ampiciltrn resistance gene, reverse primer | ATAATACCGCGCCACATAGC |
CAT-R | 5' end of chloramphenicol resistance gene, reverse primer | GCAACTGACTGAAATGCCTC |
CMV Forward | Human CMV immediate early promoter, forward primer | CGCAAATGGGCGGTAGGCGTG |
CRE-R | 5' end of Cre recombinase, reverse primer | GCAAACGGACAGAAGCATTT |
EF-1a Forward | Human elongation factor-1a promoter, forward primer | TCAAGCCTCAGACAGTGGTTC |
GAL1 | S. cerevisiae GAL1 promoter, forward primer | AATATACCTCTATACTTTAACGTC |
Gal10pro-F | S. cerevisiae GAL10 promoter, forward primer | GGTGGTAATGCCATGTAATATG |
Gal4 N-term | 3' end of Gal4 DNA binding domain, forward primer | GAGTAGTAACAAAGGTCAA |
Gal4-AD | 3' end of Gal4 activation domain, forward primer | AATACCACTACAATGGAT |
GFP-F | 3' end of GFP, forward primer | GGTCCTTCTTGAGTTTGTAAC |
GFP-R | 5' end of GFP, reverse primer | CCATCTAATTCAACAAGAATTGGGACAAC |
IRES-F | 3' end of IRES, forward primer | TGGCTCTCCTCAAGCGTATT |
IRES-R | 5' end of IRES, reverse primer | CCTCACATTGCCAAAAGACG |
LacI-R | 5' end of LacI, reverse primer | GGCATACTCTGCGACATCGT |
LacZ-R | 5' end of LacZ, reverse primer | GACAGTATCGGCCTCAGGAA |
M13 (-21) Forward | In lacZ gene | TGTAAAACGACGGCCAGT |
M13 (-40) | In lacZ gene | GTTTTCCCAGTCACGAC |
M13 Reverse | In lacZ gene | CAGGAAACAGCTATGAC |
M13/pUC Forward | In lacZ gene | CCCAGTCACGACGTTGTAAAACG |
M13/pUC Reverse | In lacZ gene | AGCGGATAACAATTTCACACAGG |
pBAD Forward | For vectors with E. cotr araBAD promoter, forward primer | ATGCCATAGCATTTTTATCC |
pBAD Reverse | For vectors with E. cotr araBAD promoter, reverse primer | GATTTAATCTGTATCAGG |
T3 | T3 promoter, forward primer | GCAATTAACCCTCACTAAAGG |
T7 | T7 promoter, forward primer | TAATACGACTCACTATAGGG |
T7 Terminal | T7 terminator, reverse primer | GCTAGTTATTGCTCAGCGG |
Specialized Services
Order
Redirecting
© 2008-2017 Quintara Biosciences -3583 Investment Blvd, Suite 2, Hayward, CA 94545 | 625 Mt Auburn Street, Suite 105, Cambridge, MA 02138