Our Favorite Tools
These are just a few of our favorite software packages. Please let us know if you have a favorite tool that is not listed here.
Chromotogram Viewers
For Windows and Mac OS
- ssh
- ApE, A Plasmid Editor, allows alignment with GenBank files
- Finch TV (Geospiza),
- Sequencher (Genecodes)
- Staden Package, a free open source genomic analysis package
Windows Specific
Mac OS Specific
- 4Peaks (Mekentosj), supports Mac OS X 10.3 or above
- ebiotools, a free open source genomics package for Mac OS X 10.3 or above
- Edit View (ABI)
Primer Design
- Primer3, online primer design on DNA template
- PrimerX, automated design of mutagenic primers for site-directed mutagenesis based on DNA or protein sequence
Utilities
- Stuffit Expander, to decompress zip file for Mac OS and Windows
- Winzip, another compress/decompress tool
- Mac Conversion Script, to convert .ab1 file for Edit View
Other Tools
- Oligo Calculator, calculate Tm, GC content, and Molecular Weight of your oligo
- PrimerBank, a primer database for human and mouse genes
- qbtools
Frequently Asked Questions
How should I submit samples?
Should I resuspend my samples in water?
What strains of E coli should I use?
What tips do you have for designing primers?
How should I submit samples?
| Type | Mixed? | Preparation |
|---|---|---|
| Plasmid | Premixed | 0.5ug plasmid DNA + 3pmol primer in 12ul dH2O |
| Unmixed | 0.5ug plasmid DNA in 10ul dH2O | |
| PCR | Premixed | 100ng/1000bp purified PCR product + 1pmol primer in 12ul dH2O |
| Unmixed | 100ng/1000bp unpurified PCR product in 10ul dH2O |
You can find detailed information on the Sample Preparation page.
Should I resuspend my samples in water?
Avoid EDTA in submitted template or primer solutions. We strongly recommend to re-suspend template or primer in 10 mM Tris (pH 8.5) or water.
How do I prepare plasmids for sequencing?
- Plasmid DNAs purified through most commercial kits are suitable for DNA sequencing. Please consult your special supplier for further information.
- Low copy number plasmids need to be further concentrated before sequencing. These plasmid can be concentrated by ETOH precipitation, centricon spin column, or use our template amplification service (RCA).
You can find detailed information on the Sample Preparation page.
What strains of E coli should I use?
- E.coli strains can be shipped as single colonies on agar plates. Please use endA- strains such as Dh4α, HB101, and XL1-Blue. The agar should not be too liquid for shipment.
What tips do you have for designing primers?
- Primer Length: 20-25 bases
- Base composition: about 50% GC
- Avoid secondary structures: hairpins, palindromic sequence, dimers, and more 3 Gs or 3 Cs in a stretch
- Avoid multiple binding sites on the template: putative binding sites are defined as 80% of your primer sequence or 100% of last 7 bases on the 3' end aligned to another site on the template.
- The 1st readable base starts about 50 bases downstream of the primer binding site.
Available Common Primers
| Click to view details | Complete list in Excel |
|---|---|
| 3'AOX1 | |
|
For Pichia vectors with AOX1 terminator, reverse primer GCAAATGGCATTCTGACATCC |
|
| 5'AOX1 | |
|
For Pichia vectors with AOX1 promoter, forward primer GACTGGTCCAATTGACAAGC |
|
| Alpha-factor | |
|
Alpha factor signal sequence, forward primer TACTATTGCCAGCATTGCTGC |
|
| Amp-R | |
|
5' end of ampiciltrn resistance gene, reverse primer ATAATACCGCGCCACATAGC |
|
| CAT-R | |
|
5' end of chloramphenicol resistance gene, reverse primer GCAACTGACTGAAATGCCTC |
|
| CMV Forward | |
|
Human CMV immediate early promoter, forward primer CGCAAATGGGCGGTAGGCGTG |
|
| CRE-R | |
|
5' end of Cre recombinase, reverse primer GCAAACGGACAGAAGCATTT |
|
| EF-1a Forward | |
|
Human elongation factor-1a promoter, forward primer TCAAGCCTCAGACAGTGGTTC |
|
| GAL1 | |
|
S. cerevisiae GAL1 promoter, forward primer AATATACCTCTATACTTTAACGTC |
|
| Gal10pro-F | |
S. cerevisiae GAL10 promoter, forward primer GGTGGTAATGCCATGTAATATG |
|
| Gal4 N-term | |
3' end of Gal4 DNA binding domain, forward primer GAGTAGTAACAAAGGTCAA |
|
| Gal4-AD | |
3' end of Gal4 activation domain, forward primer AATACCACTACAATGGAT |
|
| GFP-F | |
3' end of GFP, forward primer GGTCCTTCTTGAGTTTGTAAC |
|
| GFP-R | |
5' end of GFP, reverse primer CCATCTAATTCAACAAGAATTGGGACAAC |
|
| IRES-F | |
3' end of IRES, forward primer TGGCTCTCCTCAAGCGTATT |
|
| IRES-R | |
5' end of IRES, reverse primer CCTCACATTGCCAAAAGACG |
|
| LacI-R | |
5' end of LacI, reverse primer GGCATACTCTGCGACATCGT |
|
| LacZ-R | |
5' end of LacZ, reverse primer GACAGTATCGGCCTCAGGAA |
|
| M13 (-21) Forward | |
In lacZ gene TGTAAAACGACGGCCAGT |
|
| M13 (-40) | |
In lacZ gene GTTTTCCCAGTCACGAC |
|
| M13 Reverse | |
In lacZ gene CAGGAAACAGCTATGAC |
|
| M13/pUC Forward | |
In lacZ gene CCCAGTCACGACGTTGTAAAACG |
|
| M13/pUC Reverse | |
In lacZ gene AGCGGATAACAATTTCACACAGG |
|
| pBAD Forward | |
For vectors with E. cotr araBAD promoter, forward primer ATGCCATAGCATTTTTATCC |
|
| pBAD Reverse | |
For vectors with E. cotr araBAD promoter, reverse primer GATTTAATCTGTATCAGG |
|
| T3 | |
T3 promoter, forward primer GCAATTAACCCTCACTAAAGG |
|
| T7 | |
T7 promoter, forward primer TAATACGACTCACTATAGGG |
|
| T7 Terminal | |
T7 terminator, reverse primer GCTAGTTATTGCTCAGCGG |
|
© 2008-2011 Quintara Biosciences - 636 San Pablo Avenue, Albany, CA 94706
